to top page


TOP > June 2011 >Zygomycota >585

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
585June 2011ZygomycotaUncultured MortierellalesFJ440914
100
2
263
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTTTTGAAAATCGCCTTCATGGTGGTTTTTTAATTACATCAACCAATTTTAACAAATTTGTCTTAAAAATTCTTGAATAAATATAATTCAAAAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA