to top page


TOP > June 2011 >Zygomycota >584

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
584June 2011ZygomycotaUncultured MortierellalesGQ219867
100
17
271
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACAATGAGTGTTTTATGGCACTCTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTGTTGGGAGAGAGGCAACTCTTTCCCTTCACAAATATCAACCTATATCTTTAACAACATTCGTCTGATAACATATTATGAATATACTTAATTCAAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC