to top page


TOP > June 2011 >Glomeromycota >583

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
583June 2011GlomeromycotaUncultured GlomusAM942456
92
1
220
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATTATGGTGAACCTCGCGATAGCGAGGTTTTGCATCCATTATTTTTATATTTAAAACATTCGCTCTTTAAAAAATTATTTTTAATGATAAAATTAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA