to top page


TOP > June 2011 >Glomeromycota >582

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
582June 2011GlomeromycotaUncultured GlomusAY236305
98
1
229
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGATTTTTTTAAGCAAACCGTAGCGAAAGCGAGGTTTTGCGAATATATTTAAAACCCCCCACTCTTTAATAAAAGAAAATTTTTTCATATTCATAAATGAATAAAAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA