to top page


TOP > June 2011 >Glomeromycota >581

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
581June 2011GlomeromycotaUncultured GlomusAY236264
98
1
223
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATCATGGCGAACCTCGTGTTTCGCGAGGTCTTACGTCCATTTTTCGTATTTAAAACATCCCACTCTTTAAAAAAATATTTATCTAATGATAAAAATAAAAAGATCACTTTCAACCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA