to top page


TOP > June 2011 >Glomeromycota >580

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
580June 2011GlomeromycotaUncultured GlomeromycotaHM162343
98
1
216
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATATAGCGAACCGAGCGTTAGCGAGGCTTCGCGATCAATTGTATTTAAAACCCAACTCTTTAAATGTATATTATTATTGTATTTTAAATAATAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA