to top page


TOP > June 2011 >Glomeromycota >579

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
579June 2011GlomeromycotaUncultured GigasporaceaeDQ400263
97
1
189
-

Sequence

CTTGGTCATTTAGGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAAATTTGGGGGTATTTTATACCTCTGTATTTAAAACCCAACTCTTTAAACTTCATATTTTTAAATAAAATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA