to top page


TOP > June 2011 >Glomeromycota >578

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
578June 2011GlomeromycotaAmbispora gerdemanniiJF439210
97
2
246
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGAACGGGGAGGCGTGCTCTCGGTTTCTCCGGGAATCGGGACGCGCTTCCTTTTAGTATCCAAATTCATTATTTTTCTGTTTCGGAATTCGGCGATTATATGCTCGATTCCAAAATGTAATATAAACAAAACTTTCAACAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCA