to top page


TOP > June 2011 >Basidiomycota >577

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
577June 2011BasidiomycotaXeromphalina campanellaHQ604741
97
4
359
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAACGAATCGGGGAACTGTTGCTGGCCCGTCACAGGGCATGTGCACGCTCCTCAATTTTCCTTCTCCACCTGTGCACCCTTTGTAGACTTTGGAGGACCTCTCGAGGCAACTCGGATGGAGGGTCGCTGATTCGTTTCGGCTTCCCTTGCGCTTCCAGGTCTATGCATTTTATACACACTTTGAATGTCTTAGAATGTCTTTCATGGCTTGCCGTAAAAAAGCAAAGCTTTAAAACTGAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC