to top page


TOP > June 2011 >Basidiomycota >576

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
576June 2011BasidiomycotaUncultured TomentellaEU625838
97
1
316
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAACTGTCAACACGAGTTGTTGCTGGTCCTCAAATGGGGGCATGTGCACACTCTGTTTACACACCCACTCACACCTGTGCACCCTCTGTAGTTCTGTGATGTGGGGGACTCTGTCCTCCCACCGTGGTTCTGCATCTTTACACACACACACAGTTATAAAGTCTCATGGAATGTATATCGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC