to top page


TOP > June 2011 >Basidiomycota >575

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
575June 2011BasidiomycotaUncultured TomentellaEU625881
98
1
315
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAATTGTCAACACGAGTTGTTGCTGGTCCCTCAAACGGGGACATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGCGTGGGGGACACTGTCCCCCTTGCTGTGGTTCTATGTCTTTACGCACACACTGTAATAAAGTCTCATGGAATGTAGTCGCGTTTAACGCAATATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC