to top page


TOP > June 2011 >Basidiomycota >574

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
574June 2011BasidiomycotaUncultured SebacinaceaeFM995580
96
15
285
-

Sequence

CTTGGTCATTTAGTAGGAAGTAAAAGTACGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGATTGTCGAGTGGTTGCCTTCGGTGCTGGCTTTTGCAAGTGCACGTTGGTGGCTTTCTATCCAATACCCTTGTGAACCTTTGGCCTCTTGCTAGTTTCGGCTTAGGCAGAGGATTTTTACACACTCGAATGTAATGAAAACTATGTTGTGCGCAAGCACTAATGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC