to top page


TOP > June 2011 >Basidiomycota >573

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
573June 2011BasidiomycotaUncultured RussulaGQ219954
89
9
185
-

Sequence

CTTGGTCATTTAGAGGAAGTACAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTGTCGCTAACTTTGTGCACACCTTGGTACTCTCTCACATACAATCCATCTCACCCCCTCTTGTGTCATCACCGCGTGGGGACCCCCTTTGGCTA