to top page


TOP > June 2011 >Basidiomycota >572

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
572June 2011BasidiomycotaUncultured RussulaGQ219911
90
1
334
-

Sequence

CTTGGTCATTAGAGGAAGTAAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACGTGGGGTTGTCGCTTAACTTTGTGCACACCTTGGTACTCTCTCACATACAATCCATCTCCTACCCCTTTTGTGCATCACCGCGGTCGGGGTACCCCCTTTGGCTAGTTCTGGTAGGGGGGTTTTCTACGTTTTTACATAGACCTACCCTTTTAATGCAATGTGTAGAATGTCATTACTTTTTGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC