to top page


TOP > June 2011 >Basidiomycota >571

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
571June 2011BasidiomycotaUncultured HebelomaJQ724055
99
4
274
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTCACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCCAAACTCTGAATTATTGTGTCGTCTGAGAACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC