to top page


TOP > June 2011 >Basidiomycota >570

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
570June 2011BasidiomycotaUncultured CryptococcusHE977548
99
13
224
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAACGCCCTCACGGGCTTATAACTATTCCAAACCTCTGTGAACCGTGCCCCTTCGGGGCTATTTTACAAACATGGTGTAATGAACGTCATATATCATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA