to top page


TOP > June 2011 >Basidiomycota >569

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
569June 2011BasidiomycotaUncultured CorticialesFM997950
98
4
312
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAATTTAATTCCGGGGTTGTAGCTGGCCATCGTTTTGGCATGTGCACGCCCTGGTAATCCAAATTACTTACACCTCTGTGCACTATTATGTGGGATTGATGAAGCTTCGGTGCTTGCGCTGATGGCATTATCATTCTCATGTTTTCATATACACTCTTCAGTTTAGAATGTTATTGCGTCAAACGCATCTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC