to top page


TOP > June 2011 >Basidiomycota >568

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
568June 2011BasidiomycotaUncultured CeratobasidiaceaeDQ182419
94
1
292
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAATTTAGGATTTGGTTTGATGCTGGCCCAAGGGCATGTGCACGCCATCTCCTTCATCCACACACACCTGTGCACTTGTGAGACGGAGGATTAATTTCTTCCGTCTACTAATACACACAAACTCATTGTAATTGAACTGAATGTAGTTGATGTAACACATCTATTTGAACTAAGTTTCAACAACGGATCTCTTGGCTNTCGCATCGATGAAGAACGC