to top page


TOP > June 2011 >Basidiomycota >567

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
567June 2011BasidiomycotaUncultured BasidiomycotaGU328589
93
762
327
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTACGTAAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTTGTCGCTAACTTTTGTGCACACCTTGGTACTCTCCCACATACAATTCCATCTCACCCCTTTTGTGCATCACCGCGTGGGGACCCCCTTTTGGCTAGTTCTGAGGGGGGTTTTCACGTTTTTACATAGACACCCTTTTAATGCAATGTGTAGAATGTCATACTTTTTGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC