to top page


TOP > June 2011 >Basidiomycota >566

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
566June 2011BasidiomycotaUncultured BasidiomycotaGU328503
92
9
277
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGATCGATTCGGGACTGTGCTGGCGCAAGCAACGTGCACATCCCTTCTCATCCACACACACCCGTGCACTTGTTGGGTGGCGCTCTCGAACGAAGCCGCTCATTTTTCACACACGCCATTGTCATTTTGGGAATGTAGTCGTTTATGAAATACAAATACAACTTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGC