to top page


TOP > June 2011 >Basidiomycota >565

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
565June 2011BasidiomycotaUncultured basidiomyceteAM902013
95
3
284
-

Sequence

CTTGGTCATTTAGAAGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAACCTTTGAGGGTTGAGCTGGCGATTTACTTCGCATGTGCTTACCCTCTCATCCTTTATACACCTGTGCACCTTTTGAGGGGATAGTAGACATATGTCGAGATCCCCTCTAACACATACACTTTTATTTATTATCGAATGTTCAAACGCTTAACAGCATTTAAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC