to top page


TOP > June 2011 >Basidiomycota >564

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
564June 2011BasidiomycotaBoletus pulverulentusEU819453
89
1
310
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTGTAATCGGAGTTGATGCTGGCAGCTTGGCTGCATGTGCTCGCTCCTAACAATCTTCATCCAAACACCTGTGCACCCATTGTAGGCCCTCGAAAGAGGATCTACGTATTTCATACAACACCCACTTAGCATGTCCATAGAATGTCAAATCATAGGATCGTCCTTCGGGGCGGTATCTACGAAATCAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC