to top page


TOP > August 2010 >Zygomycota >262

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
262August 2010ZygomycotaUncultured MortierellalesGQ219867
99
16
272
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACAATGAGTGTTTTATGGCACTCTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTGTTGGGAGAGAGGCAACTCTTTCCCTTCACAAATATCAACCTATATCTTTAACAACATTCGTCTGATAACATATTATGAATATACTTAATTCAAAATATAACTTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC