to top page


TOP > August 2010 >Zygomycota >261

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
261August 2010ZygomycotaUncultured MortierellalesFJ440914
99
49
265
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTTTTGAAAATCGCCTTCATGGTGGTTTTTTAATTACATCAACCAATTTTAACAAATTTGTCTTAAAAATTCTTGAATAAATATAATTCAAAAAAACGACTTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA