to top page


TOP > August 2010 >Zygomycota >260

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
260August 2010ZygomycotaUncultured MortierellaceaeGQ219843
88
2
274
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATCCATAATAAGTGTTTTATGGCACTTTTAAAATCCATATCCACCTTGTGTGCAATGTCATCTCTTTGCCGTGGTTTTAGAACCGTGGCTCTGAGGTTATATATCTACTCAATCTTGAAATCATTTGTCTAGAAAATATTATGAATTACCTAATTCAAAATACAACTTTCAACAACGGATACTCTTGGCTCTCGCATCGATGAAGAACGC