to top page


TOP > August 2010 >Zygomycota >259

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
259August 2010ZygomycotaUncultured MortierellaHQ212098
97
1
259
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTATGGCACTTTTAAATCCATATCCACCTTGTGTGCAATGTTTGAAAATCGCCTTCATGGTGGTTTTTAATTACATCAACCAATTTTAACAAATTGTCTTAAAAATTCTTGAATAAATATAATTCAAAAAACAACTTTACAACAACGGAATCTCTTGGCTCTCGCATCGATGAAGAACGCA