to top page


TOP > August 2010 >Zygomycota >258

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
258August 2010ZygomycotaUncultured MortierellaFN565294
99
2
287
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATCAAGTGTTTTTATGGCACTTTCAAAAATCCATATCCACCTTGTGTGCAATGTCATCTCACTGGAGGTCAACGGCTGTAAAAATCCGTTGGTCACCTTTGGGATTTATATCTACTCAGAACTTTAGTGATTTTGTCTGAAACATATTATGAATACTTAATTCAAAATACAACTTTCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC