to top page


TOP > August 2010 >Glomeromycota >257

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
257August 2010GlomeromycotaUncultured GlomusJN195705
97
5
221
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATCATGGCGAACCTCGCATTTCGCGAGGTCTTGCGTTCATTTTTCGTATTTAAAACATGCCACTCTAAAAAAAATATTTATCTAATGATAAAAATAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA