to top page


TOP > August 2010 >Glomeromycota >256

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
256August 2010GlomeromycotaUncultured GlomusAM497782
95
1
219
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAAAATTTTCATATATTAATTTATTTAATATATAAAATTATATTCAAAACCCACACTCTTTATAACCAAAAAAATATTATATATTTAATATATATATAAAAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA