to top page


TOP > August 2010 >Glomeromycota >255

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
255August 2010GlomeromycotaUncultured GlomusAY236264
99
6
222
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATCATGGCGAACCTCGTGTTTCGCGAGGTCTTACGTCCATTTTTCGTATTTAAAACATCCCACTCTTTAAAAAAATATTTATCTAATGATAAAAATAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA