to top page


TOP > August 2010 >Glomeromycota >254

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
254August 2010GlomeromycotaUncultured GlomusAY236239
93
2
234
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATCATGGCGAACCTCGCGGTTTCGCGAGGTCATGCGTCCATTTTTTATTATTCGTATTTAAAACATCCCACTCTTTGAAAAAAAATATATTTATCCAATGATAAAAATAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA