to top page


TOP > August 2010 >Glomeromycota >253

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
253August 2010GlomeromycotaUncultured GlomeromycotaJX096590
98
2
217
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATATAGCGAACCGAGCGTTAGCGAGGCTTCGCGATCAATTTGTATTTAAAACCCAACTCTTTAAATGTATATTATTATTGTATTTTAAATAATAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA