to top page


TOP > August 2010 >Glomeromycota >252

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
252August 2010GlomeromycotaUncultured DiversisporaHE775318
98
1
218
-

Sequence

TTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAACTTTTATCCGGGAATTCGTTTCGTCTTCCCGGATTATTTGTATTCAAATTCCACTCTTTATAAATATATCAATTTATATAAAACAAAAATAAAAAAGAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA