to top page


TOP > August 2010 >Glomeromycota >251

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
251August 2010GlomeromycotaUncultured ArchaeosporaAM420390
97
6
266
-

Sequence

CTTGGTCATTTAGAGGAAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAAGGGTCGCAAGACCCATTTTAAAACCTACCACCACCTATCATTTGTGGCCTGTCTATGGGTGAGATGGAGGAGGTAATGGTTTTTTAAAATCCAATTATTATAAATATATATATCGTCTAATGACGAAATAAAAAAATTTCTAAAAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA