to top page


TOP > August 2010 >Glomeromycota >250

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
250August 2010GlomeromycotaGlomus indicumGU059549
99
1
222
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCAATATAGCGAACCGAGCGTTAGCGAGGTTTCGCGATCAAATTTGTATTTAAAACCCAACTCTTTAAATGTATATATTATTATTGTATTTTAAATAATAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA