to top page


TOP > August 2010 >Glomeromycota >249

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
249August 2010GlomeromycotaGlomus indicumGU059549
96
1
229
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATATAGCGAACCGAGCGTTAGCGAGGCTTCGCGATCAAATTTGTATTTAAAACCCAACTCTTTAAATGTATATTATTATTATTATTATTGTATTTTAAATAATAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA