to top page


TOP > August 2010 >Glomeromycota >248

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
248August 2010GlomeromycotaGlomus drummondiAJ972466
90
2
252
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAAAATTTTCTACGTATTTTAAATATGTAAAAAATCTTGTATTCAAAACCCACACACTTTTAAAACCATAATAAAAAAATTTTTATGTTGCATAAAATTTTTTATATAAATTATTATATATAATATAATTAAAAGACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA