to top page


TOP > 2013-02-01 >Basidiomycota >2212

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
22122013-02-01BasidiomycotaUncultured StereumFN539062
86
18
305
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAAATTCTGACTGAGGTTGTAGCTGGCGCCCTACCCGCGCATGTGCACGCCTCTTTCACAATCCACTCACACCTGTGCACCTTCGCGTGGGTCCGGGGTAACACCTGGGCTCGCGTCCCTTTTTACAAACTCTTTTGTATGTCCTCAGAATGTACATCATTGATGTCTTTAAAAACGCATCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG