to top page


TOP > 2013-02-01 >Basidiomycota >2209

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
22092013-02-01BasidiomycotaUncultured RussulaGQ219954
91
1
329
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTGTCGCTAACTTTGTGCACACCTTGGTACTCTCTCACATACAATCCATCTCACCCCTTTTGTGCATCACCGCGTCGGGGACCCCCTTTGGCTAGTTCTGGTAGGGGGGTTTTCACGTTTTACATAGACTACCTTTTAATGACAATGTGTAGAATGTACATTAACTTTTTGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG