to top page


TOP > 2013-02-01 >Basidiomycota >2206

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
22062013-02-01BasidiomycotaUncultured HebelomaJQ724055
98
1
276
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTCACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCCAAACTCTGAATTATTGTGTCGTCTGAGAACTATATAATAGTTAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG