to top page


TOP > 2013-02-01 >Basidiomycota >2201

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
22012013-02-01BasidiomycotaUncultured BasidiomycotaGU328532
90
34
326
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACTTTGAAGGGGAGAGGGGAAGGCTGTCGCTGGCTCTCTCGAGCATGTGCACGCCTTTCCTTCTCTTCATGCAAACCTACACCTGTGCACCCATTGTAGGCCCTCGAAACGAGGATCTACGTATTTCATACAACACCCACTTAGCATGTCCATAGAATGTCAAATCATAGGATCGTCCTTCGGGCGGTATCTACGAAATCAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAACGAACGCAG