to top page


TOP > 2013-02-01 >Basidiomycota >2195

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21952013-02-01BasidiomycotaUncultured basidiomyceteAM901912
98
17
316
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTACTATTGACTTTGATGCTGGCCGCTTGCGGCATGTGCTCGAGTCTTTAAATCCACTCAACCACTGTGCACTAATTCGAAAGCTTCGTGGTTCAGGCTCCTTCCTTCGGGAGGTCGAGTTCGGGCTTGCGGGGTTTTCGAGCTTCATACAAACCACATATTGTCATGTCGAATGTAATACTTTATTAAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATCCGAAGAACGC