to top page


TOP > 2013-02-01 >Basidiomycota >2190

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21902013-02-01BasidiomycotaSkeletocutis odoraFJ903307
99
7
309
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAAAGGGGTTGTAGCTGGCCTTTCGGGGCATGTGCACGCCTCGCTCATTTCCAACTCTAACACCTGTGAACTAGCTGTAGGTCGGTGTAGGAGTCGGTTCTAACGAGCCTTCTTCAAGCCTTCCTATGTCTTTAACAAACTCCAACAGTATCAGAATGTATTCGCGCTTTATAAACGCATCAATATAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC