to top page


TOP > 2013-02-01 >Basidiomycota >2188

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21882013-02-01BasidiomycotaPhlebia livida subsp. tuberculataHQ153421
99
1
297
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACTATCGAGGGTTGTTGCTGGGTGTCAAAAGACACCATGTGCACGCCTTCATAATTCTCAAACCCCTGTGCACCTATTGTAGGCTGGTCGTAGGGCTGACTTCGGTCGGTCTGAAAGCCAGGCTATGTTTACACACGCTTCAGTTTAAGAATGTCATTTGCGGATAACGCATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC