to top page


TOP > 2013-02-01 >Ascomycota >2175

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21752013-02-01AscomycotaUncultured VolutellaGQ219815
94
1
283
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTATCGTTGCCTCGGCGGGAAAGCCCCGGGCGCTGGCGCAAGCCTTCGCACCGGTACCGGGCGCCCGCCGCAGGACCTAAACAAACCCTTGAATTCTAAAGCATCTTCTGAGTGGTATAAGCAAATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG