to top page


TOP > 2013-02-01 >Ascomycota >2166

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21662013-02-01AscomycotaUncultured AscomycotaFN562054
98
69
284
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAAGAGTTGCAAAACTCCCAAACCATTGTGAACATACCTTCAACGTTGCTTCGGCGGGTTGGCCCCGGTCTCCGGGGTCCCCGGCCCTACTCGGGCGCCCGCCGGAGGTATCTAACTCTTGAACTTTTATGGCCTCTCTGAGTCTTTGTACTTAATAAGTCAAAACTTTCAACAACGGTATCTCGTTGGTTCGTGGCATCGATAGAACGAACGCACG