to top page


TOP > 2013-02-01 >Ascomycota >2165

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21652013-02-01AscomycotaUncultured AscomycotaAB636442
98
2
235
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGAATGGCCTTTTGGGCCTTCAACCTTCAAAACATGTGGAAGCAAGATGTGCTTCGGTGCCTCTGGTGCCGCCTTTATGCAGTGAAGCCTTATTTGTCTGAACCAAAATCAAAAGTTAAACTTTCAACAAAGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG