to top page


TOP > 2013-02-01 >Ascomycota >2161

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21612013-02-01AscomycotaPenicillium paxilliJN617687
100
2
290
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTAACGAACCCTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCTCTCTGCCCCCGGGCCCGCGCCCGCCGAAGACCCCTGTGAACGCTGTCTGAAGTTGCAGTCTGAGAAACTAGCTAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAG