to top page


TOP > 2013-02-01 >Ascomycota >2160

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21602013-02-01AscomycotaPenicillium aculeatumGU566285
99
18
295
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGTGGCCCAACCTCCCACCCTTGTCTCTATACACCCGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGTTCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAACTTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAG