to top page


TOP > 2013-02-01 >Ascomycota >2153

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21532013-02-01AscomycotaEmericella rugulosaEU289916
99
1
269
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCCCCAGGGGGCGAGCCGCCGGGGACCACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGCCTGAATACAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGC